View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3496_high_14 (Length: 230)
Name: NF3496_high_14
Description: NF3496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3496_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 217
Target Start/End: Original strand, 10760712 - 10760916
Alignment:
| Q |
13 |
cagagaaattaggtgaaccctctagattccaatgtgtatatggttgggatttcacgaagcccaatttcttatttaaatctgatgttctatcagttgctca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760712 |
cagagaaattaggtgaaccctctagattccaatgtgtatatggttgggatttcacgaagccgaatttcttatttaaatctgatgttctatcagttgctca |
10760811 |
T |
 |
| Q |
113 |
agagattataagatgcaaaacacctatcagcattttaacacaagtccaatcccaaagtcaagcttatgttaaagtctctattcaagttgaaggcaagaaa |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760812 |
agagataataagatgcaaaacacctatcagcatattaacacaagtccaatcccaaagccaagcttatgttaaagtctctattcaagttgaaggcaagaaa |
10760911 |
T |
 |
| Q |
213 |
atatt |
217 |
Q |
| |
|
||||| |
|
|
| T |
10760912 |
atatt |
10760916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University