View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3496_low_10 (Length: 331)
Name: NF3496_low_10
Description: NF3496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3496_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 20 - 302
Target Start/End: Original strand, 39907758 - 39908040
Alignment:
| Q |
20 |
actaacttgggtgtcggagcacaaacggataaaacaccccctttcccctcaatgggatgtggccatcatatcctcagagtacctactttcgtggatccac |
119 |
Q |
| |
|
||||||||| |||||||||||||| | |||||||||| || |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39907758 |
actaacttgagtgtcggagcacaatcagataaaacactccatttcccctcaatgggatgtggccatcatatcctcggagtacctactttcgtggatccac |
39907857 |
T |
|
| Q |
120 |
taccactgtgagtatctttatcctctttgggtaaatttttcgactagttatgaacataagtcttataaaagtacagtactcgtaaattttagaagagaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39907858 |
taccactgtgagtatctttatcctctttgggtaaatttttcgactagttatgaacataagtcttataaaagtacagtactcgtaaatttttcaagagaat |
39907957 |
T |
|
| Q |
220 |
cttatattctagaactgtttaatttttctaatcatacttagtcaacttggaccaatcctactttaaccaactgtcttaactaa |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39907958 |
cttatattctagaactgtttaatttttctaatcatacttggtcaacttggaccaatcctactttaaccaactgtcttaactaa |
39908040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 102 - 156
Target Start/End: Original strand, 4027959 - 4028013
Alignment:
| Q |
102 |
ctactttcgtggatccactaccactgtgagtatctttatcctctttgggtaaatt |
156 |
Q |
| |
|
|||||| ||| | ||||| |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
4027959 |
ctacttccgtcgctccaccaccactgtaagtatctttatcctctttggataaatt |
4028013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 121 - 157
Target Start/End: Complemental strand, 6119861 - 6119825
Alignment:
| Q |
121 |
accactgtgagtatctttatcctctttgggtaaattt |
157 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
6119861 |
accactgtaagtatctttatcctctttggctaaattt |
6119825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University