View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3496_low_14 (Length: 245)
Name: NF3496_low_14
Description: NF3496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3496_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 10 - 237
Target Start/End: Complemental strand, 41444464 - 41444237
Alignment:
| Q |
10 |
tgttgttgttgtgatcatggtccatggagagtcagtgtagtatactttgacttaagcctgctagaaagaagcttaaaactgtttatctctttctcccctt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41444464 |
tgttgttgttgtgatcatggtccatggagagtcagtgtagtatactttgacttaagcctgctagaaagaagcttaaaactgtttatctctttctcccctt |
41444365 |
T |
 |
| Q |
110 |
attaattcttccatcttcagaactgtatagtnnnnnnnnnntattcctatctctcttttgcaaatctacataattctaccaaaacaaaggcagtgaggca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41444364 |
attaattcttccatcttcagaactgtatagtaaaaaaaaaatattcctatctctcttttgcaaatctacataattctaccaaaacaaaggaagtgaggca |
41444265 |
T |
 |
| Q |
210 |
gtgtgttgggtatggctcacaggttctg |
237 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
41444264 |
gtgtgttgggtatggctcataggttctg |
41444237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University