View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3496_low_17 (Length: 201)
Name: NF3496_low_17
Description: NF3496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3496_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 54638807 - 54638973
Alignment:
| Q |
18 |
ggaatgtttttggatatttacataatctagttgttaatatctgaatttgataggaaaaggctagaaaagtaattagtaggaactaggaactaataatatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54638807 |
ggaatgtttttggatatttacataatctagttgttaatatctgaatttgataggaaaaggctagaaaagtaattagtaggaactaggaactgataatatt |
54638906 |
T |
|
| Q |
118 |
ataagcctggctatccttctattccagcaccatataatcctaaaggagtaaattgtgtcatttttca |
184 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
54638907 |
ataaatctggctatccttctattccagcaccatataatcctaaaggagtaagttgtgtcatttttca |
54638973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University