View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3498_high_3 (Length: 224)
Name: NF3498_high_3
Description: NF3498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3498_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 44 - 206
Target Start/End: Original strand, 4510337 - 4510499
Alignment:
| Q |
44 |
agaaaacatataatatttttgctcaaaaaagatcaaatgccaagaaagttgcttaccgacgataagtatagtacatatttgactatatgaggtcagtgta |
143 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4510337 |
agaaaacatataatatttttgctcaagaaagatcaaatgccaagaaagttgcttaccgacgataagtatagtacatatttgactatatgaggtcagtgta |
4510436 |
T |
 |
| Q |
144 |
caagtatcatacaatatgattgaatccatttagattgatccagtgacgttggtttaggacctt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
4510437 |
caagtatcatacaatatgattgaatccatttagattggtccggtgacgttggtttaggacctt |
4510499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University