View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3498_low_2 (Length: 241)
Name: NF3498_low_2
Description: NF3498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3498_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 32086383 - 32086605
Alignment:
| Q |
1 |
tgatttcaaaatgctggaattacttcaattaatcaggaaatacatactactatatttgcagtaacaaaattcaagtaactaagataagaatctaacaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32086383 |
tgatttcaaaatgctggaattacttcaattaatcagaaaatacatactactatatttgccgtaacaaaattcaaataactaagataagaatctaacaatc |
32086482 |
T |
 |
| Q |
101 |
cannnnnnngtatcaggcgttgatagctaatagaattggttattcactatctgatgcaaccttctcgatatacttcaatggtatggctcttccataggtg |
200 |
Q |
| |
|
|| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32086483 |
catttttttgtatcaggcattgatagctaatataattggttattcactatctgatgcaaccttctcgatatacttcaatggtatggctcttccatagatg |
32086582 |
T |
 |
| Q |
201 |
acatggcataatctcccaagtac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32086583 |
acatggcataatctcccaagtac |
32086605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University