View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3499_low_15 (Length: 349)
Name: NF3499_low_15
Description: NF3499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3499_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 11 - 255
Target Start/End: Original strand, 47286213 - 47286457
Alignment:
| Q |
11 |
cacagatcatgattgtagcttccatggagatttggttttcgtctaatggaagaagaacagatgatcctgaactaggatagttatgaggatcaccacctgg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286213 |
cacagatcatgattgtagcttccatggagatttggttttcgtctaatggaagaagaacagatgatcctgaactaggatagttatgaggatcaccacctgg |
47286312 |
T |
 |
| Q |
111 |
aatctcaggaaattctttaacagcgacgttttgtttgtaatcaaataaaatggatcgtgtgtttgcgaaaatgaaaaggtttccattaggtagaagatga |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286313 |
aatctcaggaaattctttaacaacgacgttttgtttgtaatcaaataaaatggatcgtgtgtttgcgaaaatgaaaaggtttccattaggtagaagatga |
47286412 |
T |
 |
| Q |
211 |
acgaatggatataagttgttttcgcttggatcgttagtttcttgg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286413 |
acgaatggatataagttgttttcgcttggatcgttagtttcttgg |
47286457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 301 - 334
Target Start/End: Original strand, 47286503 - 47286536
Alignment:
| Q |
301 |
gtcgttgttttaggaatgaattcatagttgaatt |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47286503 |
gtcgttgttttaggaatgaattcatagttgaatt |
47286536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University