View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3499_low_17 (Length: 278)
Name: NF3499_low_17
Description: NF3499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3499_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 49708357 - 49708112
Alignment:
| Q |
18 |
gtatttgtgttccagggtttgtgtttggacggcattgatgttaattttgcttgcaattttcaatgcttgcaatattatcactagatttacaagaattgca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49708357 |
gtatttgtgttccagggtttgtgtttggacggcattgatgttaattttgcttgcaattttcaatgcttgcaatattatcactagatttacaagaattgca |
49708258 |
T |
|
| Q |
118 |
ggggagttatttggcatgctaatcactgttcttttctttcaagaggctataaaggtgttgttgattgtttcctctttctagcaaaaataaaatacattgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49708257 |
ggggagttatttggcatgctaatcactgttcttttctttcaagaggctataaaggtgttgttgattgtttcctctttctagcaaaaataaaatacattgt |
49708158 |
T |
|
| Q |
218 |
gtatttaattggcaatcaacttaacaaaaattgtttgaaccacagg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49708157 |
gtatttaattggcaatcaacttaacaaaagttgtttgaaccacagg |
49708112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 25 - 173
Target Start/End: Original strand, 2233435 - 2233583
Alignment:
| Q |
25 |
tgttccagggtttgtgtttggacggcattgatgttaattttgcttgcaattttcaatgcttgcaatattatcactagatttacaagaattgcaggggagt |
124 |
Q |
| |
|
|||| |||||||||||||||||| ||||| || | || ||||||||||||||||||| || ||||||||||| ||||| || |||||| ||| | |
|
|
| T |
2233435 |
tgttgcagggtttgtgtttggacatcattgttgctgatgctgcttgcaattttcaatgcatgttcaattatcactaggtttactagggttgcagaggaat |
2233534 |
T |
|
| Q |
125 |
tatttggcatgctaatcactgttcttttctttcaagaggctataaaggt |
173 |
Q |
| |
|
|||||| |||| |||| |||||||||||| | ||| |||||||| |||| |
|
|
| T |
2233535 |
tatttgccatgttaattactgttcttttcatgcaacaggctatagaggt |
2233583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University