View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3499_low_21 (Length: 243)
Name: NF3499_low_21
Description: NF3499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3499_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 83 - 161
Target Start/End: Complemental strand, 16984348 - 16984270
Alignment:
| Q |
83 |
acaaattaaactcaattaggattgagattactctttttctgaaggtttttgattgtgttagagcccaaagtcaaaatgt |
161 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16984348 |
acaaattgaactcaattaggattgagattactctttttctgaaggtttttgattgtgttagagcccaaagtcaaaatgt |
16984270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 182 - 219
Target Start/End: Complemental strand, 16984270 - 16984233
Alignment:
| Q |
182 |
tagaaaataagcctaaaacattgctcctttactctaga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16984270 |
tagaaaataagcctaaaacattgctcctttactctaga |
16984233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University