View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3499_low_7 (Length: 529)
Name: NF3499_low_7
Description: NF3499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3499_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 8e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 130 - 278
Target Start/End: Complemental strand, 16165776 - 16165633
Alignment:
| Q |
130 |
gaggttatcacgaatgaagtttaaattccgcctttgaacttggtttttcgtttctatttcattttaattttgaaaaaataatgtttgttagctactttgt |
229 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
16165776 |
gaggttatcaggaatgaagtttaaattccgcctttgaacttggtttttcgtttctatttcattttaattttgaacaaa-----tttgttagctgctttgt |
16165682 |
T |
 |
| Q |
230 |
aattttcgttctttgtaattgtgtttggttagttcccttgtaacatata |
278 |
Q |
| |
|
||||||||||||| |||||||||| | ||||||||||||||||| |||| |
|
|
| T |
16165681 |
aattttcgttcttcgtaattgtgtctcgttagttcccttgtaacctata |
16165633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University