View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3500_high_22 (Length: 252)
Name: NF3500_high_22
Description: NF3500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3500_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 236
Target Start/End: Complemental strand, 33767202 - 33766979
Alignment:
| Q |
12 |
ataggcgataaatcaatggtttctattggtaataatgatgtgatttgtttagtatttttggatgctggatcagatgctgcaaatgcatctcaagttggtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33767202 |
ataggcgataaatcaatggtttctattggtaataatgatgtgatttgtttggtatttttggatgttggatcagatgctgcaaatgcatctcaagttggtt |
33767103 |
T |
|
| Q |
112 |
ttgtggttctaaaataatgactttaattggagaataataatttgttgcaatttgatttgcatacttttaaggtattcttattagtatattggtttcttaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33767102 |
ttgtggttctaaaataatgactttaattggagaataataatttgttgcaatttgatttgccta-ttttaaggtattcttattagtatattggtttcttaa |
33767004 |
T |
|
| Q |
212 |
caagtgcctcacggcaattagttag |
236 |
Q |
| |
|
| |||||||||| |||||||||||| |
|
|
| T |
33767003 |
ctagtgcctcaccgcaattagttag |
33766979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 119
Target Start/End: Complemental strand, 33777508 - 33777432
Alignment:
| Q |
43 |
ataatgatgtgatttgtttagtatttttggatgctggatcagatgctgcaaatgcatctcaagttggttttgtggtt |
119 |
Q |
| |
|
|||| |||||||||||||| | ||| ||||||||||||| ||| |||||| | ||||||||||||||||||||| |
|
|
| T |
33777508 |
ataaggatgtgatttgtttgggttttgtggatgctggatctgattttgcaaaaacttctcaagttggttttgtggtt |
33777432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University