View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3500_high_27 (Length: 244)
Name: NF3500_high_27
Description: NF3500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3500_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 5 - 238
Target Start/End: Original strand, 1725995 - 1726229
Alignment:
| Q |
5 |
gaggaacgggcgaggagcacttaggggctgcgtctattgatggcatcttgatggacctgggcatgtcatctatgcaggttcatttccctgctttatatag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1725995 |
gaggaacgggcgaggagcacttaggggctgcgtctattgatggcatcttgatggacctgggcatgtcatctatgcaggttcatttccctgctttatatag |
1726094 |
T |
 |
| Q |
105 |
gaacatacactgacttgctttcttgtgatgtgtcatattcatggttatatatcgcagttata-ttttttcttaaagacgtgttgaaatgctatgttttgt |
203 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1726095 |
gaacatacactgacttgctttcttgtgttgtgtcatattcatggttatatatcgcagttatatttttttcttaaagacgtgttgaaatgctatgttttgt |
1726194 |
T |
 |
| Q |
204 |
ggctgtagaatgtagttcaaaaccatgatgatgtc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1726195 |
ggctgtagaatgtagttcaaaaccatgattatgtc |
1726229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University