View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3500_high_28 (Length: 240)
Name: NF3500_high_28
Description: NF3500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3500_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 43578393 - 43578611
Alignment:
| Q |
18 |
ttcccaaaacaacactgaatcaaccactcaccccatcaagctttcaaccaaagccagaagaaaagctgctcaagaatcccccgttggaattttacnnnnn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43578393 |
ttcccaaaacaacactgaatcaaccactcaccccatcaagctttcaaccaaagccagaagaaaagctgctcaagaatcccccgttggaattttacaaaaa |
43578492 |
T |
 |
| Q |
118 |
nn-ctcaacaactgttctaaaaccagtgatgttctacaagcactaaacctctacgacgaagcgcgaaaagcgcatgttcccctcaatcttgatcattata |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43578493 |
aaactcaacaactgttctaaaaccagtgatgttctacaagcactaaacctctacgatgaagcgcgaaaagcgcatgttcccctcaatcttgatcattata |
43578592 |
T |
 |
| Q |
217 |
ataaactcttgtacctatg |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
43578593 |
ataaactcttgtacctatg |
43578611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University