View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3500_low_15 (Length: 293)
Name: NF3500_low_15
Description: NF3500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3500_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 20 - 286
Target Start/End: Original strand, 23128271 - 23128537
Alignment:
| Q |
20 |
actttgccaccaacttcgaaccaatcaacgctttaatctcatcccttagcctcgggtcggatacaatccatgaagtttgtttcttacactcttcatcaaa |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23128271 |
acttcgccaccaacttcgaaccaatcaacgctttaatctcatcccttagcctcgggtcggatacaatccatgaagtttgtttcttacactcttcatcaaa |
23128370 |
T |
|
| Q |
120 |
cgcagcattgaattttacaaaaatagccttaacttgctccaccgtcttctccgccgtggaattttcattttccggcaacgttgacaaaaccttattccat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23128371 |
cgcagcattgaattttacaaaaatagccttaacttgctccaccgtcttctccgccgtggaattttcattttccggcaacgttgacaaaaccttattccat |
23128470 |
T |
|
| Q |
220 |
ccaatttgaacaaatttgttcacgtactctttcaccttcaattcatgattcgttaaccattcttctc |
286 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23128471 |
ccaatttgaacaaatttgttcacatactctttcaccttcaattcatgatttgttaaccattcttctc |
23128537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University