View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3500_low_19 (Length: 264)
Name: NF3500_low_19
Description: NF3500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3500_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 246
Target Start/End: Original strand, 30901287 - 30901513
Alignment:
| Q |
20 |
tgtgggtttgctggattatcctttagtagtgattgtttaaggttgnnnnnnnnnngttcacttgtaggaattgttgcatctctattagggttttgatttt |
119 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30901287 |
tgtgggttcactgaattatcctttagtagtgattgtttaaggttgttttttttttgttcacttgtaggaattgttgcatctctattagggttttgatttt |
30901386 |
T |
|
| Q |
120 |
gtgatttaatggtaaggttctttgccccccattttgtacttccttttctttttaaattaacttttattttgtctagnnnnnnnttaaccgtgaactgacc |
219 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30901387 |
gtaatttaatggtaaggttctttgccccccattttgtacttccttttctttttaaattaacttttattttgtctagaaaaaaattaaccgtgaactgacc |
30901486 |
T |
|
| Q |
220 |
aactaaagaaaaattgtgggacagagg |
246 |
Q |
| |
|
|||||||||| | |||||||||||||| |
|
|
| T |
30901487 |
aactaaagaatatttgtgggacagagg |
30901513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University