View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3500_low_23 (Length: 252)

Name: NF3500_low_23
Description: NF3500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3500_low_23
NF3500_low_23
[»] chr1 (2 HSPs)
chr1 (12-236)||(33766979-33767202)
chr1 (43-119)||(33777432-33777508)


Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 236
Target Start/End: Complemental strand, 33767202 - 33766979
Alignment:
12 ataggcgataaatcaatggtttctattggtaataatgatgtgatttgtttagtatttttggatgctggatcagatgctgcaaatgcatctcaagttggtt 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||    
33767202 ataggcgataaatcaatggtttctattggtaataatgatgtgatttgtttggtatttttggatgttggatcagatgctgcaaatgcatctcaagttggtt 33767103  T
112 ttgtggttctaaaataatgactttaattggagaataataatttgttgcaatttgatttgcatacttttaaggtattcttattagtatattggtttcttaa 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||    
33767102 ttgtggttctaaaataatgactttaattggagaataataatttgttgcaatttgatttgccta-ttttaaggtattcttattagtatattggtttcttaa 33767004  T
212 caagtgcctcacggcaattagttag 236  Q
    | |||||||||| ||||||||||||    
33767003 ctagtgcctcaccgcaattagttag 33766979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 119
Target Start/End: Complemental strand, 33777508 - 33777432
Alignment:
43 ataatgatgtgatttgtttagtatttttggatgctggatcagatgctgcaaatgcatctcaagttggttttgtggtt 119  Q
    |||| |||||||||||||| |  ||| ||||||||||||| |||  ||||||  | |||||||||||||||||||||    
33777508 ataaggatgtgatttgtttgggttttgtggatgctggatctgattttgcaaaaacttctcaagttggttttgtggtt 33777432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University