View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3500_low_32 (Length: 227)
Name: NF3500_low_32
Description: NF3500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3500_low_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 15 - 151
Target Start/End: Complemental strand, 9151742 - 9151595
Alignment:
| Q |
15 |
cacagatcttataaaataaacaaaggaaagaagtatatgaagctaagcgttgtg-----------gccaagctaaaaagactgtgatttacaaacattta |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9151742 |
cacagatcttataaaataaacaaaggaaagaagtatatgaagctaagcgttgtactaagcctctagccaagctaaaaagactgtgatttacaaacattta |
9151643 |
T |
|
| Q |
104 |
aggcaaatggcttttaaaaggttgaatgacttattagtagaatcgttc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9151642 |
aggcaaatggcttttaaaaggttgaatgacttattagtagaatcgttc |
9151595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 9151581 - 9151535
Alignment:
| Q |
161 |
gttgagaaaaaatttaggtgtgcatggatggtacctctcaagtaggtgg |
209 |
Q |
| |
|
|||||| ||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
9151581 |
gttgaggaaaaatttaggtgcg--tggatggtacctctcaagtaggtgg |
9151535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 43
Target Start/End: Original strand, 9176776 - 9176804
Alignment:
| Q |
15 |
cacagatcttataaaataaacaaaggaaa |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9176776 |
cacagatcttataaaataaacaaaggaaa |
9176804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University