View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3500_low_7 (Length: 414)
Name: NF3500_low_7
Description: NF3500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3500_low_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 17 - 414
Target Start/End: Original strand, 1725547 - 1725944
Alignment:
| Q |
17 |
agaaactgggggattaagaccatnnnnnnntatactttgtatatccttataaattttcatgtcattataagaggattttgactctcccattcccttcaag |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1725547 |
agaaactgggggattaagaccataaaaaaatatactttgtatatccttataaattttcatgtcattataagaggattttgactctcccattcccttcaag |
1725646 |
T |
|
| Q |
117 |
aaattgaatcacacaataaagatttaaaattattaccctcctcgtctctatttctcttcaaccaaatactatgtaaaaatgttgattttgatgcatgtta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1725647 |
aaattgaatcacacaataaagatttaaaattattactctcctcgtctctatttctcttcaaccaaatactatgtaaaaatgttgatttcgatgcatgtta |
1725746 |
T |
|
| Q |
217 |
gattttcttttattagtggtgcttatgcacaaagctcatctttctctgttatttcttgctattgaatggttgaatggaataggtgattagaggtcatccg |
316 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1725747 |
gatttttttttattagtggtgcttatgcacaaagctcatctttctctgttatttcttgctattgaatggttgaatggaataggtgattagaggtcatccg |
1725846 |
T |
|
| Q |
317 |
gagttgaagtattttgttgggatggatgtggaccctgtggggcgtgacacggctcaatcccgcatcagttcagttttggacgatagggagtctagtgt |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1725847 |
gagttgaagtattttgttgggatggatgtggaccctgtggggcgtgacacggctcaatcccgcatcagttcagttttggacgatagggagtctagtgt |
1725944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University