View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3500_low_9 (Length: 364)
Name: NF3500_low_9
Description: NF3500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3500_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 15 - 356
Target Start/End: Original strand, 3629475 - 3629818
Alignment:
| Q |
15 |
aaaaaattcccaaaggtctgcaataatattatccttatcatttcaaagaccacacatataaattgtggcaattattttttcacttaatttgtcacctttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3629475 |
aaaaaattcccaaaggtctgcaataatattatccttatcatttcaaagaccacacatataaattgtggcaattattttttcacttaatttgtcacctttt |
3629574 |
T |
|
| Q |
115 |
aatatttctgactaggtacataattggattgcttataaatactctcattggttcattttcttgtcagtgtaaattgagtggctgattcaactatttaatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3629575 |
aatatttctgactaggtacataattggattgcttataaatactctcattggttcattttcttgtcagtgtaaattgagtggctgattcaactatttaatt |
3629674 |
T |
|
| Q |
215 |
cgttgatcaa--nnnnnnnnnatttggctaaatattcgtttatcatggctttgaatttgccctccccagctcaagtgaaaccctcatttttctctgatat |
312 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3629675 |
cgttgatcaatttttttttttatttggctaaatattcgttgatcatggctttgaatttgccctccccagctcaagtgaaaccctcatttttctctgatat |
3629774 |
T |
|
| Q |
313 |
catcaacccagttatcacccccacaaaacttccaggttcatctc |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3629775 |
catcaacccagttatcacccccacaaaacttccaggttcttctc |
3629818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University