View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3501_high_3 (Length: 242)
Name: NF3501_high_3
Description: NF3501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3501_high_3 |
 |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0180 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 15936 - 16147
Alignment:
| Q |
17 |
agtaagttcatccaattctccttcaaactctttcatttgatttattatatttatcgctaaattaatctcaattcttcgttttctgcgatttttcatttcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15936 |
agtaagttcatccaattctccttcaaactctttcatttgatttattatatttatcgctaaattaatctcaattcttcgttttctgcgatttttcatttcc |
16035 |
T |
 |
| Q |
117 |
tttagttttaactctgagaaatatgtatttgagtacttgctttcaaatgggtatgtgtaagttcttaactttttaggtttcatttcaatttctgcactgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16036 |
tttagttttaactctgagaaatatgtatttgagtacttgctttcaaatgggtatgtgtaagttcttaactttttaggtttcatttcaatttctgcactgt |
16135 |
T |
 |
| Q |
217 |
atttttattgtc |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
16136 |
atttttattgtc |
16147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University