View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3502_high_11 (Length: 241)
Name: NF3502_high_11
Description: NF3502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3502_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 47248148 - 47247946
Alignment:
| Q |
19 |
atattatcaaattttgggggttatgcggcttttgacaatcaattactgatggccacatgctgctggactggatcttggtatatatagtaatccaatcact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47248148 |
atattatcaaattttgggggttatgcggcttttgacaatcaattactgatggccacatgctgctggactggatcttggtatatatagtaatccaatcact |
47248049 |
T |
 |
| Q |
119 |
gatgctgactgcttgttaacttttgatgataatccgcttgtactactaatggctatgcctatttcactgtgttcaagttgtcactttttaatacagccta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47248048 |
gatgctgactgcttgttaacttttgatgataatccgcttgtactactaatggctatgcctatttcactgtgttcaagttgtcacttt----tacagccta |
47247953 |
T |
 |
| Q |
219 |
tgctctg |
225 |
Q |
| |
|
||||||| |
|
|
| T |
47247952 |
tgctctg |
47247946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 47241607 - 47241571
Alignment:
| Q |
186 |
tgtgttcaagttgtcactttttaatacagcctatgct |
222 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
47241607 |
tgtgttcaagttgtcacttgttaatacaacctatgct |
47241571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University