View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3502_high_12 (Length: 240)
Name: NF3502_high_12
Description: NF3502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3502_high_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 3 - 240
Target Start/End: Original strand, 2327463 - 2327699
Alignment:
| Q |
3 |
taggtgcttaactaactatataagtgaaaagaataatgtttacgagacttatctcaaaatacaacatattcttctagatctgacagcattttggatgcag |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2327463 |
taggtgcttaactaactatataagtgaaaagaataatgtt-atgagacttatctcaaaatacaacatattcttctagatctgacagcattttggatgcag |
2327561 |
T |
 |
| Q |
103 |
tgtttcttacaggcttcttcacagatacaccgatatagcaccattctcagggttaacccccacataaaccagataacacactttggtattgaattaacct |
202 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2327562 |
tgtttcttacaggcttcatcacagatacaccgatatagcaccattctcagggttaacccccacatataccagataacacactttggtattgaattaacct |
2327661 |
T |
 |
| Q |
203 |
tttcagtgtgccccccttgaaaaatcaacaattttcga |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2327662 |
tttcagtgtgccccccttgaaaaataaacaattttcga |
2327699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University