View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3502_low_5 (Length: 375)
Name: NF3502_low_5
Description: NF3502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3502_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 22 - 320
Target Start/End: Complemental strand, 5487194 - 5486896
Alignment:
| Q |
22 |
ccgcggagcatcacacagtaatgcaagttgaaatacatcaactagattatccattgtgagtaaacccaattctagcttctgttcacattctcgtttcaag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5487194 |
ccgcggagcatcacacagtaatgcaagttgaaatacatcaactagattatccattgtgagtaaacccaattctagcttctgttcacattctcgtttcaag |
5487095 |
T |
 |
| Q |
122 |
tgagggaccgcgtatacatgagacagcaccaacaaatgtaggacaaattccttcatttcttctttctcgtaactgaaaaaaggcacaaaatttcagcaca |
221 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5487094 |
tgagggaccgcatatacatgagacagcaccaacaaatgtaggacaaattccttcatttcttctttctcgtaactgaaaaaaggcacaaaatttcagcaca |
5486995 |
T |
 |
| Q |
222 |
tttatatgatgcaaaatgcatttcagccacagcaactacgatgcattcaaaaaaggacagtagtaactctgtaaccttgatcagctatgttgatctcct |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5486994 |
tttatatgatgcaaaatgcatttcagccacagcgactatgatgcattcaaaaaaggacagtagtaactctgtaaccttgatcggctatgttgatctcct |
5486896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University