View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3503_high_11 (Length: 250)
Name: NF3503_high_11
Description: NF3503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3503_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 40484164 - 40484404
Alignment:
| Q |
1 |
cgtttataagttgaagttgttgttaaatatacaaaggatcccgtgttaattttagctgttgcactacaggcaggtcttaaaataatagaattgtatatgg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40484164 |
cgtttataagttgaagtttttgttaaatatacaaaggatcccgtgttaattttagctgttgcactacaggcaggtcttaaaataatagaattgtatatgg |
40484263 |
T |
|
| Q |
101 |
aaggttatcgacaagattggaagctttcatttgaaaaggatactgttagcagaggaggctggtatgtaaatttgtcctacaagaagtctta-actatcac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40484264 |
aaggttatcgacaagattggaagctttcatttgaaaaggatactgttagcagaggaggctggtatgtaaatttgtcctacaagaagtcttacactatcac |
40484363 |
T |
|
| Q |
200 |
attatctgattatccataccactcttaaaggatcttctgtg |
240 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40484364 |
attatatgattatccataccactcttaaaggatcttctgtg |
40484404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University