View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3503_low_12 (Length: 261)
Name: NF3503_low_12
Description: NF3503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3503_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 100 - 243
Target Start/End: Complemental strand, 1282184 - 1282033
Alignment:
| Q |
100 |
ttaattaatacatatgtcacaatgaagaaatttattttatttttt-ggttacaac------------ttccttcaaaaaacaatgaaggaatttatttgg |
186 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1282184 |
ttaattaatacat--gtcacaatgaagaaatttattttatttttttggttacaacaatgaaggaattttccttcaaaaaacaatgaaggaatttatttgg |
1282087 |
T |
|
| Q |
187 |
tacctcttcttactggaatttatatattaccattttttattttacaaaatatatctt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1282086 |
tacctcttcttactggaatttatatattaccatttt---ttttacaaaatatatctt |
1282033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 12 - 43
Target Start/End: Complemental strand, 1282684 - 1282653
Alignment:
| Q |
12 |
agagatggagtacatgtgggaataattgtaag |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1282684 |
agagatggagtacatgtgggaataattgtaag |
1282653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University