View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3503_low_16 (Length: 249)
Name: NF3503_low_16
Description: NF3503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3503_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 6993557 - 6993321
Alignment:
| Q |
1 |
tcaagaactgaatggtcagcgttattggagcttcgttcatcgatggggataagggggaaggagtggcctnnnnnnnctgatccatgtcggaactggaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6993557 |
tcaagaactgaatggtcagcgttattggagcttcgttcatcgatggggataagggggaaggagtggcctaaaaaaactgatccatgtcggaactggaccg |
6993458 |
T |
|
| Q |
101 |
gtgttgagtgccggaacgatcaagttgttggtatcaaagtggctgggttgaatagaacccacaaaggtcgtcttaacccaagttttgaagttgatgctct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6993457 |
gtgttgagtgccggaacgatcaagttgttggtatcaaagtggctgggttgaatagaacccacaaaggtcgtcttaacccgagttttgaagttgatgctct |
6993358 |
T |
|
| Q |
201 |
tgcaaatttcacactattggagtctttcaatgcttct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6993357 |
tgcaaatttcacactattggagtctttcaatgcttct |
6993321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University