View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3503_low_20 (Length: 216)
Name: NF3503_low_20
Description: NF3503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3503_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 9 - 198
Target Start/End: Complemental strand, 16538528 - 16538339
Alignment:
| Q |
9 |
gaggagcagagacggttgtttttcttgtcggaggggaggctggggcgggaggaggtgaagtcgcaggtggatttagggaagcggaagtggggttttaatg |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16538528 |
gaggaccagagacggttgtttttcttgtcggaggggaggctggggcgggaggaggtgaagtcgcaggtggatttagggaagcggaagtggggttttaacg |
16538429 |
T |
|
| Q |
109 |
gcgtttcgggtggaacgcatgtatcgggggtgataaggaatagagatatgagtgttactgaagctatggctatagaggctatggaaagtt |
198 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16538428 |
gcgcttcgggtggaacgcatgtatcgggggtgataaggaatagagatatgagtgttactgaagctatggctatagaggctatggaaagtt |
16538339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 9 - 103
Target Start/End: Complemental strand, 23411170 - 23411076
Alignment:
| Q |
9 |
gaggagcagagacggttgtttttcttgtcggaggggaggctggggcgggaggaggtgaagtcgcaggtggatttagggaagcggaagtggggttt |
103 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||| | || ||| |||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
23411170 |
gaggaccagagacggttgtttttcttgtgggaggggaggtggaggtgggtggaggtgaagtcgcaggtggatttggggaagcggaggtggggttt |
23411076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University