View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3503_low_21 (Length: 203)
Name: NF3503_low_21
Description: NF3503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3503_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 18 - 133
Target Start/End: Original strand, 6868887 - 6869002
Alignment:
| Q |
18 |
atgaaacagagctaagtcggagaatttgcagttaaactatctccgacgagtatataaacttattctttcttgtaatatatagggtgatattttaaaaagg |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6868887 |
atgaaacagagctaaatcggagaatttgcagttaaactatctccgacgagtatataaacttattctttcttgtaatatacagggtgatattttaaaaagg |
6868986 |
T |
|
| Q |
118 |
atgaaatatgcaatta |
133 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
6868987 |
aggaaatatgcaatta |
6869002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 47149725 - 47149668
Alignment:
| Q |
18 |
atgaaacagagctaagtcggagaatttgcagttaaactatctccgacgagtatataaactt |
78 |
Q |
| |
|
||||||||||||||| ||||| |||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
47149725 |
atgaaacagagctaaatcggaaaatttg---ttaagctatctccgacgagtatataaactt |
47149668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University