View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3504_high_3 (Length: 253)
Name: NF3504_high_3
Description: NF3504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3504_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 232
Target Start/End: Original strand, 35619141 - 35619353
Alignment:
| Q |
17 |
gatggttagagttagttcagtgggcttataaacaaactgttagagtcggttagatatagcaacagacttatccattatccattttctgtatcagtatatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35619141 |
gatggttagagttagttcagtgggcttataaacaaactgttagagtcggttagatatagcaacagacttatccattatccattttctgtatcagtatat- |
35619239 |
T |
|
| Q |
117 |
atacacttccttgctgaacattttgtttttcatgcaatgagaatggatcttgcttctgttcttcttttcccctctcttacattccttcgtattttagatt |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35619240 |
--atacttccttgctgaacattttgtttttcatgcaatgagaatggatcttgcttctgttcttcttttcccctctcttacattccttcgtattttagatt |
35619337 |
T |
|
| Q |
217 |
cctcatatggtgtcaa |
232 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35619338 |
cctcatatggtgtcaa |
35619353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University