View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3505_high_11 (Length: 246)
Name: NF3505_high_11
Description: NF3505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3505_high_11 |
 |  |
|
| [»] scaffold0257 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 117 - 206
Target Start/End: Complemental strand, 28147180 - 28147091
Alignment:
| Q |
117 |
aatgtaaccaaaataaagtattgcattatttaatttgattaatattgttatttaattttcaacactccaacccttttgtttttcaatctg |
206 |
Q |
| |
|
|||||||| |||| |||| | | || ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28147180 |
aatgtaacaaaaagaaagcactacagtatttaattaaattaatattgttatttaattttcaacactccaacctttttgtttttcaatctg |
28147091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 145 - 206
Target Start/End: Complemental strand, 28182941 - 28182880
Alignment:
| Q |
145 |
tttaatttgattaatattgttatttaattttcaacactccaacccttttgtttttcaatctg |
206 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28182941 |
tttaattaaattaatattgttatttaattttcaacaccccaacccttttgtttttcaatctg |
28182880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 135 - 206
Target Start/End: Original strand, 28521252 - 28521323
Alignment:
| Q |
135 |
tattgcattatttaatttgattaatattgttatttaattttcaacactccaacccttttgtttttcaatctg |
206 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
28521252 |
tattacattatttaattaaattaatattgtcatttacttttcaacactccaacacttttgtttttcaatctg |
28521323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 159 - 206
Target Start/End: Complemental strand, 28052354 - 28052307
Alignment:
| Q |
159 |
tattgttatttaattttcaacactccaacccttttgtttttcaatctg |
206 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28052354 |
tattgttatttaattttcgacactccaacccttttgtttttcaatctg |
28052307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 174
Target Start/End: Complemental strand, 28131632 - 28131575
Alignment:
| Q |
117 |
aatgtaaccaaaataaagtattgcattatttaatttgattaatattgttatttaattt |
174 |
Q |
| |
|
||||||||||||| |||||| | |||||||||||| ||||| |||| |||||||||| |
|
|
| T |
28131632 |
aatgtaaccaaaagaaagtactacattatttaattaaattaacattgatatttaattt |
28131575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 169
Target Start/End: Complemental strand, 28052502 - 28052450
Alignment:
| Q |
117 |
aatgtaaccaaaataaagtattgcattatttaatttgattaatattgttattt |
169 |
Q |
| |
|
|||| |||||||| |||||| | |||||||||||| |||||||||||||||| |
|
|
| T |
28052502 |
aatgcaaccaaaagaaagtagtacattatttaattaaattaatattgttattt |
28052450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 169
Target Start/End: Complemental strand, 28062927 - 28062875
Alignment:
| Q |
117 |
aatgtaaccaaaataaagtattgcattatttaatttgattaatattgttattt |
169 |
Q |
| |
|
|||| |||||||| |||||| | |||||||||||| |||||||||||||||| |
|
|
| T |
28062927 |
aatgcaaccaaaagaaagtagtacattatttaattaaattaatattgttattt |
28062875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0257 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0257
Description:
Target: scaffold0257; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 206
Target Start/End: Complemental strand, 16860 - 16808
Alignment:
| Q |
154 |
attaatattgttatttaattttcaacactccaacccttttgtttttcaatctg |
206 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
16860 |
attaatattgttatttaattttgaacactccaacccttctgtgtttcaatctg |
16808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University