View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3505_high_8 (Length: 301)

Name: NF3505_high_8
Description: NF3505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3505_high_8
NF3505_high_8
[»] chr4 (1 HSPs)
chr4 (113-291)||(49757932-49758110)


Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 113 - 291
Target Start/End: Complemental strand, 49758110 - 49757932
Alignment:
113 ccacagctgtactgacctatgctgcagctgcacctttgtccccatcaccaaataatctttgcttgaaatcagcgaccattagaggaagtccctcacggag 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49758110 ccacagctgtactgacctatgctgcagctgcacctttgtccccatcaccaaataatctttgcttgaaatcagcgaccattagaggaagtccctcacggag 49758011  T
213 ggacacagatggttgccagccaagaagctcttttgctttggagatgtctggctttctcttatgtggatcatcctctgtg 291  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49758010 ggacacagatggttgccagccaagaagctcttttgctttggagatgtctggctttctcttatgtggatcatcctctgtg 49757932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University