View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3505_high_9 (Length: 264)
Name: NF3505_high_9
Description: NF3505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3505_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 5465849 - 5466103
Alignment:
| Q |
1 |
ataatgactcaaccccaactctcttttccaaacctgcgtcccatgatgacccgaaccagttcttggagtcgggtcagtgtgtgatgaatgatgatatggt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5465849 |
ataatgactcaactccaactctcttttccaaaccagcgtcccatgatgacccgaaccagttcttggagtcgggtcagtgtgtgatgaatgatgatatggt |
5465948 |
T |
 |
| Q |
101 |
ggagagggatcattttgtttcggatacccgtcccgaattaggtggcttggacctgtttacgccttgtagtaattttatgcagaagaagatgaaaccgcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5465949 |
ggagagggatcattttgtttcggatacccgtcccgaattaggtgccttggacctgtttacgccttgtagtagttttatgcagaagaagatgaaaccgcag |
5466048 |
T |
 |
| Q |
201 |
tatgataatattgtgaaatgcaatgaatccaaaaagttgacactctcacaggttc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5466049 |
tatgataatattgtgaaatgcaatgaatccaaaaagttgacaatctcacaggttc |
5466103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University