View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3505_low_10 (Length: 269)
Name: NF3505_low_10
Description: NF3505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3505_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 2327922 - 2327682
Alignment:
| Q |
18 |
actcataaacctatggtagataatgaacttgtaaccatttgtgtaccctaaaaatcaccacacaaatttaccnnnnnnn-agagagaatcatcctacttc |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||||| |
|
|
| T |
2327922 |
actcataaacctacggtagataatgaacttataaccatttgtgtaccctaaaaaccatcacacaaatttacattttttttagagagaatcatcctacttc |
2327823 |
T |
|
| Q |
117 |
tttacccaatgttttttatgcagtaaacgannnnnnnaagccaaacctattataactgtacacacactattaagcaatagttgacaccagtttccttttt |
216 |
Q |
| |
|
|||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2327822 |
tttacccaatgttttttatgcagtgatcgatttttttaagccaaacctattataactgtacacacactattaagcaatagttgacaccagtttccttttt |
2327723 |
T |
|
| Q |
217 |
cgggaaacgaaggttggtagctatcgaaaattgttgatttt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2327722 |
cgggaaacgaaggttggtagctatcgaaaattgtttatttt |
2327682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University