View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3508_high_5 (Length: 395)
Name: NF3508_high_5
Description: NF3508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3508_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 1e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 171 - 346
Target Start/End: Complemental strand, 1583088 - 1582923
Alignment:
| Q |
171 |
atggatttaagaaaaacattgataatttaattaaaaatcatatgaaaaacgcctnnnnnnntgcacataagttttgtcattcgacaaaagctatcaaact |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
1583088 |
atggatttaagaaaaacattgataatttaattaaaaatcatatgaaaaacgcctaaaaaaatgca----------gtcattcgacaaaagttatcaaact |
1582999 |
T |
 |
| Q |
271 |
atttatttatatattttggattttgttgggttagttacggtggaaaactggcaatgtggcgtcatattttttgttt |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
1582998 |
atttatttatatattttggattttgttgggttagttacggtggaaaattggcaatccggcgtcatattttttgttt |
1582923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 11 - 86
Target Start/End: Complemental strand, 1583207 - 1583128
Alignment:
| Q |
11 |
cacagaacttgaatgaagataaatt----aatactaccaatgtctatcatatgattgcatgcgtttggaaaggacaaaac |
86 |
Q |
| |
|
|||| |||||||||||||||||| | |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1583207 |
cacataacttgaatgaagataaaattaataatattaccaatgtctatcatatgattgcatgcgtttggaaaggacaaaac |
1583128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 218
Target Start/End: Original strand, 5571717 - 5571761
Alignment:
| Q |
174 |
gatttaagaaaaacattgataatttaattaaaaatcatatgaaaa |
218 |
Q |
| |
|
|||||||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
5571717 |
gatttaagaaaatcattgacgatttaataaaaaatcatatgaaaa |
5571761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University