View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3508_low_11 (Length: 323)

Name: NF3508_low_11
Description: NF3508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3508_low_11
NF3508_low_11
[»] chr2 (2 HSPs)
chr2 (17-138)||(7775998-7776119)
chr2 (120-217)||(7776135-7776239)


Alignment Details
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 17 - 138
Target Start/End: Original strand, 7775998 - 7776119
Alignment:
17 tatggcaatcaaaacttaattaaataattaatctaacataaatgattgtaattgagacggacacgacttaaaatgcatcagctatcaacaatttgtgaca 116  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7775998 tatggcaatcacaacttaattaaataattaatctaacataaatgattgtaattgagacggacacgacttaaaatgcatcagctatcaacaatttgtgaca 7776097  T
117 tttatgtatgtgttgaattcat 138  Q
    ||||||||||||||||||||||    
7776098 tttatgtatgtgttgaattcat 7776119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 120 - 217
Target Start/End: Original strand, 7776135 - 7776239
Alignment:
120 atgtatgtgttgaattcatgtagtagatctgaaataaacagaacatataatcgggt--ttat-----aatgcgagttttatatatcgattagcaatattc 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||  |  ||||     |||||||||||||||||||||||||||||||||    
7776135 atgtatgtgttgaattcatgtagtagatctgaaataaacagaacatataatcgatttattattagcaaatgcgagttttatatatcgattagcaatattc 7776234  T
213 attaa 217  Q
    |||||    
7776235 attaa 7776239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University