View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3508_low_19 (Length: 243)
Name: NF3508_low_19
Description: NF3508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3508_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 907592 - 907801
Alignment:
| Q |
18 |
cctatcacttctcatcaccacctcttctcgaaacatgttctcgtagagctttgtatacagttccgatagcgaaactttctgttattcgaatttcatgagc |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
907592 |
cctatcacttctcatcaccatctcttctcgaaacatgttctcgtagagctttgtatacagttccgatagcgaaactttctgttattcgaatttcatgagc |
907691 |
T |
 |
| Q |
118 |
ttccaaagagctttggagttcttcaatcatcatattatttacattctttgattcttcgatggccacaacaatgtgatcagatttattaggtaatgtacgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
907692 |
ttccaaagagctttggagttcttcaatcatcatattatttacattctttgattcttcgatggccacagcaatgtgatcagatttattaggtaatgtacgc |
907791 |
T |
 |
| Q |
218 |
gtaatctttt |
227 |
Q |
| |
|
| |||||||| |
|
|
| T |
907792 |
gcaatctttt |
907801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University