View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3508_low_22 (Length: 236)
Name: NF3508_low_22
Description: NF3508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3508_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 3 - 221
Target Start/End: Original strand, 9252488 - 9252706
Alignment:
| Q |
3 |
ttgcacaagcaacttaaattgaatcatgcattatcaaatctttctaatccaattgtatgatttactactaaacttgtgaaatctttttgcattcattatg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9252488 |
ttgcacaagcaacttaaattgaatcatgcattatcaaatctttctaatccaattgtatgatttactactaaacttgtgaaatctttttgcattcattatg |
9252587 |
T |
 |
| Q |
103 |
aattgagtgaacnnnnnnnnnnaagacttttgtttgagcacaaggaaaattctaagttggggagaatagataagtgccaaaatcatattattttcattag |
202 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9252588 |
aattgagtgaactgttttttttaagacttttgtttgagcacaaggaaaattctaagttggggagaatagataagtgccaaaatcatattattttcattag |
9252687 |
T |
 |
| Q |
203 |
catttattgacttgttttt |
221 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
9252688 |
catttattgacttgttttt |
9252706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 7893161 - 7893112
Alignment:
| Q |
171 |
gataagtgccaaaatcatattattttcattagcatttattgacttgtttt |
220 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
7893161 |
gataagtgccaaaatcatgttaagctcattagcacttattgacttgtttt |
7893112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University