View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3509_high_2 (Length: 523)
Name: NF3509_high_2
Description: NF3509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3509_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 2e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 265 - 503
Target Start/End: Original strand, 25544053 - 25544293
Alignment:
| Q |
265 |
ttgtcgaaatcgaatattgtcgttttggaaatgcaaa-catactaagcagagannnnnnnnnn-acaatattagcaagatctcctttgaattagaccgtt |
362 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25544053 |
ttgtcgaaatcaaagattgtcgttttggaaatgcaaaacatactaagcagaggtttttttttttacaatattagcaagatctcctttgaattagaccgtt |
25544152 |
T |
|
| Q |
363 |
gtctagcttcatatctcaaagatgtgtctgtgtttcaagctctcggccgcggaatgagcaataatggtgtcattattgtggaggttgaaaagnnnnnnna |
462 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
25544153 |
gtctagcttcatatctcgaagatgcgtctgtgtttcaagctctcggccgccgaatgagcaataatggtgtcattattgtggaggttgaatcgttttttta |
25544252 |
T |
|
| Q |
463 |
acattgattagttcaatgttgaaactattcaatgttaaaaa |
503 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
25544253 |
acattgaatagttcaatgtttaaactattcaatgttaaaaa |
25544293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 186 - 224
Target Start/End: Original strand, 25544018 - 25544056
Alignment:
| Q |
186 |
tctatccaactacgattcgttcatgttatatgagcttgt |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25544018 |
tctatccgactacgattcgttcatgttatatgagcttgt |
25544056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University