View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3509_low_11 (Length: 226)
Name: NF3509_low_11
Description: NF3509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3509_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 47979986 - 47979772
Alignment:
| Q |
1 |
gaactctaccattgccaaaagtgtagagaaaagctatgttcacatattcatagtttcccgtggcacaagtttcagccaaggttccctcatttccattttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47979986 |
gaactctaccattgccaaaagtgtagagaaaagctatgttcacatattcatagtttcccgtggcacaagttttagccaaggttccctcatttccattttg |
47979887 |
T |
 |
| Q |
101 |
accccagtagatggaaattcctccaccatttgatcctcttgctaggatcaaaatcactagtgaaaatattatcaaagtccctagcttataacttgtcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47979886 |
accccagtagatggaaattcctccaccatttgatcctcttgctaggatcaaaatcactagtgaaaatattatcaaagtccctagcttataacttgtcatt |
47979787 |
T |
 |
| Q |
201 |
ttatgcagttttctt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47979786 |
ttatgcagttttctt |
47979772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 112
Target Start/End: Original strand, 24367954 - 24368033
Alignment:
| Q |
33 |
gctatgttcacatattcatagtttcccgtggcacaagtttcagccaaggttccctcatttccattttgaccccagtagat |
112 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| ||||| || || ||||| ||||| || || ||||||||||| |
|
|
| T |
24367954 |
gctatgatcacatattcatagtttcctgtggcacaagcctcagctaacgtgccctcgtttccgttctggccccagtagat |
24368033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 112
Target Start/End: Original strand, 24455577 - 24455659
Alignment:
| Q |
30 |
aaagctatgttcacatattcatagtttcccgtggcacaagtttcagccaaggttccctcatttccattttgaccccagtagat |
112 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||| || || | || ||||| |||||||| ||||| ||||| |
|
|
| T |
24455577 |
aaagctatgatcacatattcatagtttcttgtggcacaagtttcggctaacgagccttcattaccattttggccccaatagat |
24455659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University