View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3510_low_5 (Length: 239)
Name: NF3510_low_5
Description: NF3510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3510_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 38754362 - 38754230
Alignment:
| Q |
1 |
tagattttagagtttttacctttacaattgattttaaactcatatatatagtttaacacatttacataaatgaattcaaatacaaaccgctttacattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38754362 |
tagattttagagtttttacctttacaattgattttaaactcatatatatagtttaacatatttacataaataaattcaaatacaaaccgctttacattca |
38754263 |
T |
|
| Q |
101 |
attcaattcagttcaattttagaccaaattattttaga |
138 |
Q |
| |
|
| ||||||| |||||||| |||||| |||||||| |
|
|
| T |
38754262 |
a-----ttcagtttaattttaggccaaatcattttaga |
38754230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 144 - 223
Target Start/End: Complemental strand, 15348732 - 15348653
Alignment:
| Q |
144 |
tcctttgtatgggagtgcataagtaatttannnnnnnggttacttgcggatgcttccctctttgtggcatcctgctatct |
223 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15348732 |
tcctttgtatgggagtgcatcagtaatttatttttttggttacttgaggatgcttccctctttgtggcatcctgctatct |
15348653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 144 - 216
Target Start/End: Complemental strand, 26045385 - 26045313
Alignment:
| Q |
144 |
tcctttgtatgggagtgcataagtaatttannnnnnnggttacttgcggatgcttccctctttgtggcatcct |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26045385 |
tcctttgtatgggagtgcatcagtaatttatttttttggttacttgcggatgcttccctctttgtggcatcct |
26045313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 147 - 224
Target Start/End: Complemental strand, 23446970 - 23446893
Alignment:
| Q |
147 |
tttgtatgggagtgcataagtaatttannnnnnnggttacttgcggatgcttccctctttgtggcatcctgctatctg |
224 |
Q |
| |
|
||||||||| ||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
23446970 |
tttgtatggaagtgcatcagtaatttatttttttggttacttgaggatgcttccctctttgtggcatcctgcaatctg |
23446893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University