View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3510_low_5 (Length: 239)

Name: NF3510_low_5
Description: NF3510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3510_low_5
NF3510_low_5
[»] chr5 (1 HSPs)
chr5 (1-138)||(38754230-38754362)
[»] chr2 (1 HSPs)
chr2 (144-223)||(15348653-15348732)
[»] chr3 (1 HSPs)
chr3 (144-216)||(26045313-26045385)
[»] chr8 (1 HSPs)
chr8 (147-224)||(23446893-23446970)


Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 38754362 - 38754230
Alignment:
1 tagattttagagtttttacctttacaattgattttaaactcatatatatagtttaacacatttacataaatgaattcaaatacaaaccgctttacattca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||    
38754362 tagattttagagtttttacctttacaattgattttaaactcatatatatagtttaacatatttacataaataaattcaaatacaaaccgctttacattca 38754263  T
101 attcaattcagttcaattttagaccaaattattttaga 138  Q
    |     ||||||| |||||||| |||||| ||||||||    
38754262 a-----ttcagtttaattttaggccaaatcattttaga 38754230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 144 - 223
Target Start/End: Complemental strand, 15348732 - 15348653
Alignment:
144 tcctttgtatgggagtgcataagtaatttannnnnnnggttacttgcggatgcttccctctttgtggcatcctgctatct 223  Q
    |||||||||||||||||||| |||||||||       ||||||||| |||||||||||||||||||||||||||||||||    
15348732 tcctttgtatgggagtgcatcagtaatttatttttttggttacttgaggatgcttccctctttgtggcatcctgctatct 15348653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 144 - 216
Target Start/End: Complemental strand, 26045385 - 26045313
Alignment:
144 tcctttgtatgggagtgcataagtaatttannnnnnnggttacttgcggatgcttccctctttgtggcatcct 216  Q
    |||||||||||||||||||| |||||||||       ||||||||||||||||||||||||||||||||||||    
26045385 tcctttgtatgggagtgcatcagtaatttatttttttggttacttgcggatgcttccctctttgtggcatcct 26045313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 147 - 224
Target Start/End: Complemental strand, 23446970 - 23446893
Alignment:
147 tttgtatgggagtgcataagtaatttannnnnnnggttacttgcggatgcttccctctttgtggcatcctgctatctg 224  Q
    ||||||||| ||||||| |||||||||       ||||||||| |||||||||||||||||||||||||||| |||||    
23446970 tttgtatggaagtgcatcagtaatttatttttttggttacttgaggatgcttccctctttgtggcatcctgcaatctg 23446893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University