View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3511_low_3 (Length: 202)
Name: NF3511_low_3
Description: NF3511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3511_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 188
Target Start/End: Complemental strand, 35521008 - 35520834
Alignment:
| Q |
14 |
cacagacggcgatatctttagaatagctgaccttctcgaataaattgctcgctatcagcaaggtagcttagatatatcttcttatttctctcatttgaca |
113 |
Q |
| |
|
|||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35521008 |
cacacacgacgatatctttagaatcgctgaccttctcgaataaattgctcgctatcagcaaggtagcttagacatatcttcttatttctctcatttgaca |
35520909 |
T |
|
| Q |
114 |
acactttgggaagaattggagaatttcgaccactcaaagattgttcaagtgctattccctgcacctgtggtgctg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35520908 |
acactttgggaagaattggagaatttcgaccactcaaagattgttcaagtgctattccctccacctgtggtgctg |
35520834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University