View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3512_high_18 (Length: 237)
Name: NF3512_high_18
Description: NF3512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3512_high_18 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 304283 - 304500
Alignment:
| Q |
1 |
cgagttcttgaaataaatcaattagacatagttccaacactctgatgcataaattgaaaggtaaataaaaatatttcttcataaattaaatgaatattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
304283 |
cgagttcttgaaataaatcaattagacatagttccaacactctgatgcataaattgaaaggtaaatcaaaatatttcttcataaactaaatgaatattca |
304382 |
T |
 |
| Q |
101 |
actcgaaatcaatttggtttttacgaacggtagttgaaagagggaggggaagaacatataaaataacgcggatctnnnnnnncgcagaaatgaaaaagct |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||||| || |
|
|
| T |
304383 |
actggaaatcaatttggtttttacgaacggtagttg-aagagggaggggaagaacagataaaataacgcggatct-aaataacgcagaaatgaaaaaact |
304480 |
T |
 |
| Q |
201 |
cagattttaaacaatctcac |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
304481 |
cagattttaaacaatctcac |
304500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 20071678 - 20071807
Alignment:
| Q |
1 |
cgagttcttgaaataaatcaattagacatagttccaacactctgatgcataaattgaaaggtaaataaaaatatttcttcataaattaaatgaatattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
20071678 |
cgagttcttgaaataaatcaattagacatagttccaacactctgatgcataaattgaaaggtaaatcaaaatatttcttcataaactaaatgaatattca |
20071777 |
T |
 |
| Q |
101 |
actcgaaatcaatttggtttttacgaacgg |
130 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
20071778 |
actggaaatcaatttggtttttacgaacgg |
20071807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 220
Target Start/End: Original strand, 20071807 - 20071840
Alignment:
| Q |
187 |
gaaatgaaaaagctcagattttaaacaatctcac |
220 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
20071807 |
gaaatgaaaaaactcagattttaaacaatctcac |
20071840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University