View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3512_low_22 (Length: 207)
Name: NF3512_low_22
Description: NF3512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3512_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 19 - 192
Target Start/End: Complemental strand, 6426734 - 6426561
Alignment:
| Q |
19 |
aatcaaaagtagcaaaaatgttttcaggaattacaggtatcatcaacaggggtgaaaagttgaagggaactgtggtgttgatgcnnnnnnntgtgttgga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| || |
|
|
| T |
6426734 |
aatcaaaagtagcaaaaatgttttcaggaattacaggtatcatcaacaggggtgaaaagttaaagggaactgtggtgttgatgcaaaagaatgtgttaga |
6426635 |
T |
|
| Q |
119 |
tgtgaatgaactcacttcaattaaaagtaacccagttggtggcataattggtggtgccattagtggtgcctttg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
6426634 |
tgtgaatgaactcacttcaattaaaagtaacccagttggtggtataattggtggtgccattggtggtgcctttg |
6426561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 73 - 102
Target Start/End: Complemental strand, 6356033 - 6356004
Alignment:
| Q |
73 |
aaaagttgaagggaactgtggtgttgatgc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6356033 |
aaaagttgaagggaactgtggtgttgatgc |
6356004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 73 - 102
Target Start/End: Complemental strand, 7463134 - 7463105
Alignment:
| Q |
73 |
aaaagttgaagggaactgtggtgttgatgc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7463134 |
aaaagttgaagggaactgtggtgttgatgc |
7463105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University