View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3513_low_3 (Length: 442)
Name: NF3513_low_3
Description: NF3513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3513_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 163 - 425
Target Start/End: Complemental strand, 10111116 - 10110853
Alignment:
| Q |
163 |
gtagaagtgctttgtttggtaaacaaaatggggtttcaaatactactagacctgcttcatctggtggaagtgattcttatttaagcgattctaggtgtgt |
262 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10111116 |
gtagaagtgttttgtttggtaaacaaaatggggtttcaaatactactagacctgcttcatctggtggaagtgattcttatttaagcgattctaggtgtgt |
10111017 |
T |
 |
| Q |
263 |
atgtgtgtttgttttcataaattgagnnnnnnnatttatgggtctagcttatttgccttaaagtttgttgctttattgtgattgtatatattggtattaa |
362 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10111016 |
atgtgtgtttgttttcataaattgagtttttttatttatgggtctagcttatttgccttaaagtttgttgctttattgtgattgtatatattggtattaa |
10110917 |
T |
 |
| Q |
363 |
aatttttta-tgggtagaacaagcagaaattaaggaatgtgatggtgctctttgtttaggactt |
425 |
Q |
| |
|
| | | ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10110916 |
attatgttattgggtagaacaaacagaaattaaggaatgtgatggtgctctttgtttaggactt |
10110853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 15 - 94
Target Start/End: Complemental strand, 10111261 - 10111182
Alignment:
| Q |
15 |
gatagtgataatgatgaagttgttgaaagagggaagtttaagggtgatggcggttctggaagtattggtgagtttcttag |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
10111261 |
gatagtgataatgatgaagttgttgaaagagggaagtttaaggatgctggcggttctggaagtattggtgagtttcttag |
10111182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University