View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3514_high_4 (Length: 265)
Name: NF3514_high_4
Description: NF3514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3514_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 24 - 247
Target Start/End: Original strand, 8825826 - 8826049
Alignment:
| Q |
24 |
attaatgcccaatgttctaaattcatgagaccatagctaattttgatcaaacattttcatcatagtgtgtgttgttttttatcaaacatggtggaagaaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8825826 |
attaatgcccaatgttctaaattcatgagaccatagctaattttgatcaaacattttcatcatagtgtgtgttgttttttatcaaacatggtggaagaaa |
8825925 |
T |
|
| Q |
124 |
atagagaagaaggtagatccttagctgagacccctacttgggctgttgcaactgtcatcactcttttggtttctcttagtttcttgtctaatggcacatt |
223 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8825926 |
atagagaagaaggtagatccttagccgagacccctacttgggctgttgcaactgtcatcactcttttggtttctcttagtttcttgtctaatggcacatt |
8826025 |
T |
|
| Q |
224 |
gaaaaaattggttaaggtacatac |
247 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8826026 |
gaaaaaattggttaaggtacatac |
8826049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University