View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3514_low_6 (Length: 237)
Name: NF3514_low_6
Description: NF3514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3514_low_6 |
 | |
|
| [»] scaffold0029 (2 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 87 - 221
Target Start/End: Complemental strand, 5734472 - 5734338
Alignment:
| Q |
87 |
tgctgcattttaaagttgcggttccattcgattccaattgcttgcaactgctgattccgattgtctccgaattcacttgtccccactttcgttattgttc |
186 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5734472 |
tgctgcgttttaaagttgcggttccattcgattccaattgcttgcaactgctgattccgattgtctccgaattcacttgtccccactttcgttattgttc |
5734373 |
T |
|
| Q |
187 |
tcgttgacagaggactcgccgtcgccgtttctggt |
221 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| |
|
|
| T |
5734372 |
tcgttgacggaggactcgccctcgccgtttctggt |
5734338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 5734584 - 5734507
Alignment:
| Q |
1 |
tgtggtattactgctgctgttctgaatcggtgttcaaattcactccttgctactgtcgtgttcatattgttgttccaa |
78 |
Q |
| |
|
|||||||||||| |||||| | ||||| |||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
5734584 |
tgtggtattactactgctgctttgaattggtgttcaaattcattccttgctactgccgtgttcatattgttgttccaa |
5734507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 87 - 221
Target Start/End: Complemental strand, 12643558 - 12643427
Alignment:
| Q |
87 |
tgctgcattttaaagttgcggttccattcgattccaattgcttgcaactgctgattccgattgtctccgaattcacttgtccccactttcgttattgttc |
186 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
12643558 |
tgctgcgttttaaagttgcggttccattcgattccaattgcttgcaactgctgattccgattgtctccgaattcacttgtcc---cattcgttattgttc |
12643462 |
T |
|
| Q |
187 |
tcgttgacagaggactcgccgtcgccgtttctggt |
221 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
12643461 |
tcgttgacggaggactcgccgtcgccgtttctggt |
12643427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 12643670 - 12643593
Alignment:
| Q |
1 |
tgtggtattactgctgctgttctgaatcggtgttcaaattcactccttgctactgtcgtgttcatattgttgttccaa |
78 |
Q |
| |
|
||||||||||||||||||||| | ||| |||||||||||||| |||||||||||| ||||||||||||| |||||||| |
|
|
| T |
12643670 |
tgtggtattactgctgctgttttcaattggtgttcaaattcattccttgctactgccgtgttcatattgctgttccaa |
12643593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 87 - 139
Target Start/End: Original strand, 7158151 - 7158203
Alignment:
| Q |
87 |
tgctgcattttaaagttgcggttccattcgattccaattgcttgcaactgctg |
139 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |||| | |||||||||||||||| |
|
|
| T |
7158151 |
tgctgcatttcaaagtggcggttccattcaattcaatttgcttgcaactgctg |
7158203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 139
Target Start/End: Complemental strand, 76595 - 76543
Alignment:
| Q |
87 |
tgctgcattttaaagttgcggttccattcgattccaattgcttgcaactgctg |
139 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |||| | ||||||||| |||||| |
|
|
| T |
76595 |
tgctgcatttcaaagtggcggttccattcaattcaatttgcttgcagctgctg |
76543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 139
Target Start/End: Complemental strand, 88320 - 88268
Alignment:
| Q |
87 |
tgctgcattttaaagttgcggttccattcgattccaattgcttgcaactgctg |
139 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |||| | ||||||||| |||||| |
|
|
| T |
88320 |
tgctgcatttcaaagtggcggttccattcaattcaatttgcttgcagctgctg |
88268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University