View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3515_low_4 (Length: 339)
Name: NF3515_low_4
Description: NF3515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3515_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 158 - 324
Target Start/End: Complemental strand, 7502024 - 7501858
Alignment:
| Q |
158 |
agcttcatgttagtatgataaaggtcattcttttaaggggtagaccaagcctcagggttgtgcattatatggtttttcatcatagaacaacacatgaaaa |
257 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7502024 |
agcttcatgttagtatgttaaaggtcattcttttaaggggcagaccaagcctcagggtggtgcattatatggtttttcatcatagaacaacacatgaaag |
7501925 |
T |
 |
| Q |
258 |
tttccttgtttaaaaattagtttcatcttttgaaatggccagtaattgatatgacttgtagaacact |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7501924 |
tttccttgtttaaaaattagtttcatcttttgaaatgtccagtaattgatatgacttgtagaacact |
7501858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 8 - 121
Target Start/End: Complemental strand, 7502173 - 7502060
Alignment:
| Q |
8 |
gaagaacaagtgcagaagcaagcaccgggcggggaaagtgacgtctagtgtcatggnnnnnnnnttggtaaactaaagagttccctttttcttggtttct |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7502173 |
gaagaacaagtgcagaagcaagcaccaggcggggaaagtgacgtctagtgtcatggaaaaaaaattggtaaactaaagagttccctttttcttggtttct |
7502074 |
T |
 |
| Q |
108 |
tcatgcagttctga |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7502073 |
tcatgcagttctga |
7502060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 9 - 63
Target Start/End: Original strand, 8139599 - 8139653
Alignment:
| Q |
9 |
aagaacaagtgcagaagcaagcaccgggcggggaaagtgacgtctagtgtcatgg |
63 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| || ||||||||||||| |
|
|
| T |
8139599 |
aagaacaagtgcagaagcaagtgccgggcagggaaagtcacatctagtgtcatgg |
8139653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University