View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3515_low_6 (Length: 251)
Name: NF3515_low_6
Description: NF3515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3515_low_6 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 251
Target Start/End: Complemental strand, 5952665 - 5952432
Alignment:
| Q |
15 |
agttttgggttaagaatcaccgacacaaatatgaacggtagacacgacattggtactgacacgttagattattgatgataattttagtaaatgaatgatt |
114 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5952665 |
agtttttggttaaaaatcaccgacacaaatatgaacagtagacacgacattggtactgacacgttagattattgatgataattttagtaaatgaatgatt |
5952566 |
T |
 |
| Q |
115 |
tgaatgtacacatgtgtgttggtgtcgtgtcagtgtctggcacctacacatgtcaaacaatggacacacctttaaatcagaagaagtgtcggtgctacat |
214 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5952565 |
tgaatgtacacatgtgtgtcggtgtcgtgtcagtgtctggcacctacacatgtcaaacaatggacacacctttaaatca---gaagtgtcggtgctacat |
5952469 |
T |
 |
| Q |
215 |
agattttgaatcataatgggatacaatttttaacatt |
251 |
Q |
| |
|
||||||||| ||| |||| |||||||||||||||||| |
|
|
| T |
5952468 |
agattttgagtcagaatgagatacaatttttaacatt |
5952432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University