View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3516_high_12 (Length: 310)

Name: NF3516_high_12
Description: NF3516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3516_high_12
NF3516_high_12
[»] chr6 (1 HSPs)
chr6 (85-160)||(21442283-21442358)
[»] chr5 (1 HSPs)
chr5 (42-103)||(42650597-42650659)


Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 85 - 160
Target Start/End: Complemental strand, 21442358 - 21442283
Alignment:
85 atgtaatttcactttgcattcgtcacacgatttgtgttttttaaagtaggaggtaggtctcccttgtgtgatcatt 160  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
21442358 atgtaatttcactttgcatttgtcacacgatttgtgttttttaaagtaggaggtaggcctcccttgtgtgatcatt 21442283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 103
Target Start/End: Original strand, 42650597 - 42650659
Alignment:
42 agtttttgcttgaatctttagtgtatatgtagtaatgaatgaaa--tgtaatttcactttgcat 103  Q
    ||||||||||||||||| || | | | |||||||||||||||||  ||||||||||||||||||    
42650597 agtttttgcttgaatctctaattt-tgtgtagtaatgaatgaaaaatgtaatttcactttgcat 42650659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University