View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3516_high_19 (Length: 259)
Name: NF3516_high_19
Description: NF3516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3516_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 99 - 238
Target Start/End: Complemental strand, 23964795 - 23964675
Alignment:
| Q |
99 |
agttgatttttggtcggacctcctatgcctcccagttggttcacgactggcttccagtggttaccgattggtggttggttgcagtaagggtttgcggctg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
23964795 |
agttgatttttggtcggacctcctatgcctccaagttggttcacaactgacttccagtggttaccg-------------------aagggtttgcggctg |
23964715 |
T |
 |
| Q |
199 |
ttatatttttcgggttttgatatgagtggaagtctcgata |
238 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23964714 |
ttatatttttcgggttttgatatgaatggaagtctcgata |
23964675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 23964845 - 23964794
Alignment:
| Q |
1 |
ctcataaaactaaacatgaggttaacctttcactaatctcgacttctctcag |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23964845 |
ctcataaaactaaacatgaggttaacctttcactaatctcgacttctctcag |
23964794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University